|
|
|
2
|
|
Sector
|
Education And Research Institute Tenders
|
Tender Value
|
N.A.
|
|
Location
|
Himachal Pradesh Tenders
|
Ref.No
|
82275160
|
|
Closing Date
|
24 - Apr - 2025
|
27 Days to go
|
View Tender Details
|
|
Tender Invited For Platinum Coated Silicon Wafer, Titanium Target, Zinc Target, Cobalt Target, Titanium Pellets, Zinc Pellets, Cobalt Pellets, Alumina Ceramic boat Crucible, Alumina Ceramic Crucible, Thin Films Sample Box, Silver paste, FTO Substrates, ITO Substrates, Nickel Foam, Carbon Cloth, Quartz Tubes, Kimwipes disposable wipers, Silica gel
Qty:6296
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
10
|
|
Sector
|
Education And Research Institute Tenders
|
Tender Value
|
N.A.
|
|
Location
|
Himachal Pradesh Tenders
|
Ref.No
|
82312454
|
|
Closing Date
|
16 - Apr - 2025
|
19 Days to go
|
View Tender Details
|
|
Tender Invited For Potassium hydroxide 1000 g, 4 percent Paraformaldehyde 500 ml, Phenol chloroform isoamyl alcohol 300 ml, Sodium carbonate 500 g, Thiobarbituric acid 125 g, Sodium hydroxide 1000 g, Superoxide Dismutase antioxidant assay kit calorimetric 1, Riboflavin 100 g, Trypan Blue zero point four percent Solution 50 ml, Guaiacol 250 g, Iron chloride FeCl3 100 g, Potassium Ferricyanide 100 g, Iodine 100 g, Dichloromethane 100 ml, Iron sulfate FeSO4 500 g, Sodium Hypochlorite NaOCl 500 ml, Perchloric Acid HClO4 500 ml, Zinc Chloride ZnCl2 500 g, Sodium Iodide NaI 500 g, Phosphate Buffer 500 ml, DNA Extraction Kit for Animal tissue 2, PCR kit 2, PBS Phosphate buffered saline 1000 ml, Sodium Chloride 1000 g, Bouins fixative 500 ml, Bradford reagent 1000 ml, ALT Activity kit Calorimetric 50 rxn, AST Activity kit Calorimetric 50 rxn, ALP Activity kit Calorimetric 50 rxn, Giemsa stain 50 ml, Ethanol 15 L, Nitroblue tetrazolium NBT 25 g, S Acetylthiocholine iodide 25 g, Potassium cyanide 500 g, Drabkins reagent 500 ml, Hayemis RBC diluting fluid 100 ml, Turks WBC diluting fluid 100 ml, Heparin anticoagulant 50 ml, Hydrogen peroxide 1500 ml, 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g, Glutathione Reduced GSH 25 g, Two point five percent Glutaraldehyde 500 ml, Diethyl ether AR 1000 ml, Petroleum ether AR grade 2500 ml, Pyrogallol 100 g, Nitric acid 1000 ml, Perchloric acid 1000 ml, Glacial acetic acid 1500 ml, L tryptophan extrapure 100 mg, Barium chloride dehydrate 500 g, Gum acacia 500 g, Magnesium chloride hexahydrate 500 g, Potassium nitrate 500 g, Methyl cellosolve 1000 ml, Citric acid 500 g, Sodium citrate tribasic dehydrate extrapure 98 percent 500 g, Anthrone ACS 98 percent 25 g, N propanol 1000 ml, Ammonium metavanadate 100 g, Phenol crystalline extrapure AR 500 g, Boric acid 500 g, Papain 100 g, Ferric chloride hexahydrate A 100 g, Starch 1000 g, Donepezil hydrochloride 1, Master mix PCR 100 rxn, DPPH 2 g, ATBS 5 g, CTAB 3 kit, Mcnkey broth 500 g, MHA muller hinton broth 500 g, Sterile disc 2 pack, Plate count agar 500 g, M17 agar 500 g, M17 broth 500 g, Ox bile Ox gall 500 g, MHA agar 500 g, MRS broth 1000 g, MRS agar 1000 g, Pepsin cysteine 25 g each, X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g, 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g, Columbia agar 500 g, DNA extraction kit for bacteria 1 pack, Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 1492R 5 TACGGTACCTTGTTACGACTT3, Wurster reagent N N N N tetramethyl pphenylenediamine 10 g, Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each, D Arabinose 100 g, D Reffinose 100 g, Gram staining kit 200 ml reagents, Trypsin 10 g, Nutrient Agar 500 g, Nutrient Broth 500 g
|
|
|